Propagation of PadR regulog to Bacillus subtilis subsp. subtilis str. NCIB 3610

Reference regulog properties
Source regulog:	PadR - Bacillales
Regulator type:	Transcription factor
Regulator family:	PadR
Regulation mode:	repressor
Biological process:	Phenolic acid stress response
Effector:	p-Coumaric acid; Ferulic acid
Phylum:	Firmicutes
Propagated regulon:
Target genome	Bacillus subtilis subsp. subtilis str. NCIB 3610
Orthologous TF(s)	BsubsN3_010100004579
Regulated genes	1

Built upon 5 sites [see more]

Predicted regulatory interactions in *Bacillus subtilis subsp. subtilis str. NCIB 3610*
	Locus tag	Position	Score	Sequence
Position: -192 Score: 6.8 Sequence: GAACATGTAAATAGTTACATGATT Locus tag: BsubsN3_010100018567
	BsubsN3_010100018567	-192	6.8	GAACATGTAAATAGTTACATGATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: yveG
Ortholog function: Hypothetical protein
Bacillus amyloliquefaciens FZB42	RBAM_031740	-95	7.1	AAACGTGTAAATAGTTACATGTTT
Bacillus subtilis subsp. subtilis str. 168	BSU34410	-48	6.8	GAACATGTAAATAGTTACATGATT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --