Propagation of CzrA regulog to Oceanobacillus iheyensis HTE831

Reference regulog properties
Source regulog:	CzrA - Bacillales
Regulator type:	Transcription factor
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Zinc resistance; Nickel resistance; Copper resistance; Cobalt resistance; Cadmium resistance
Effector:	Zinc ion, (Zn2+); Silver ion, (Ag+); Nickel ion, (Ni2+); Copper ion, (Cu2+); Cobalt ion, (Co2+); Cadmium, ion (Cd2+)
Phylum:	Firmicutes
Propagated regulon:
Target genome	Oceanobacillus iheyensis HTE831
Orthologous TF(s)	OB1400
Regulated genes	1

Built upon 16 sites [see more]

Predicted regulatory interactions in *Oceanobacillus iheyensis HTE831*
	Locus tag	Position	Score	Sequence
Position: -39 Score: 6.7 Sequence: AATATGAGCATATGATCATATT Locus tag: OB1400
	OB1400	-39	6.7	AATATGAGCATATGATCATATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: czrA
Ortholog function: Transcriptional repressor of multiple metal-sensing, ArsR family
Anoxybacillus flavithermus WK1	Aflv_1335	-41	7.2	TATATGAACATATATTCATATA
Geobacillus kaustophilus HTA426	GK1406	-43	7.1	TATATGAACAAATGCTCATATA
Geobacillus kaustophilus HTA426	GK0580	-48	7	CATATGAACATATGCTCATATA
Bacillus clausii KSM-K16	ABC3390	-36	6.8	AATATGAACATATAATCATATA
Oceanobacillus iheyensis HTE831	OB1400	-39	6.7	AATATGAGCATATGATCATATT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --