Propagation of NagR regulog to Oceanobacillus iheyensis HTE831

Reference regulog properties
Source regulog:	NagR - Bacillales
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	N-acetylglucosamine utilization
Effector:	N-acetylglucosamine-6-phosphate
Phylum:	Firmicutes
Propagated regulon:
Target genome	Oceanobacillus iheyensis HTE831
Orthologous TF(s)	OB0612
Regulated genes	1

Built upon 14 sites [see more]

Predicted regulatory interactions in *Oceanobacillus iheyensis HTE831*
	Locus tag	Position	Score	Sequence
Position: -55 Score: 5.4 Sequence: TAACATGTATAGACAACTGT Locus tag: OB0611
	OB0611	-55	5.4	TAACATGTATAGACAACTGT
Supported by regulated orthologs from reference regulons
Ortholog gene name: nagB
Ortholog function: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
Bacillus clausii KSM-K16	ABC1490	-79	6.5	TAATTGGTATAGACAACTAA
Oceanobacillus iheyensis HTE831	OB0611	-55	5.4	TAACATGTATAGACAACTGT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --