Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of Rex regulog to Bacillus sp. NRRL B-14911

Reference regulog properties
Source regulog: Rex - Bacillales
Regulator type: Transcription factor
Regulator family: Rex
Regulation mode: repressor
Biological process: Energy metabolism
Effector: NADH
Phylum: Firmicutes
Propagated regulon:
Target genome Bacillus sp. NRRL B-14911
Orthologous TF(s) B14911_20105
Regulated genes 2
Built upon 64 sites [see more]
Predicted regulatory interactions in Bacillus sp. NRRL B-14911
Locus tag Position Score Sequence
Position: -121
Score: 4.9
Sequence: TTCGTGAAGAATATCACAAA
Locus tag: B14911_09402
B14911_09402 -121 4.9 TTCGTGAAGAATATCACAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: ndh2
Ortholog function: NADH dehydrogenase (EC 1.6.99.3)
Bacillus licheniformis DSM 13 BLi03392 -119 4.9 AAAGTGAAGGGTTTCACAAA
Anoxybacillus flavithermus WK1 Aflv_2402 -76 5.5 TTCGTGAATAAATTCACAAA
Geobacillus kaustophilus HTA426 GK2953 -102 5.6 AACGTGAATTATTTCACAAA
Bacillus clausii KSM-K16 ABC2924 -55 4.8 AAAGTGAAATGAATCACAAA
Paenibacillus sp. JDR-2 Pjdr2_4834 -64 5.7 ATTGTGTAATTTTTCACAAA
© 2009-2020 RegPrecise