Propagation of YybR/YdeP regulog to Lysinibacillus sphaericus C3-41

Reference regulog properties
Source regulog:	YybR/YdeP - Bacillales
Regulator type:	Transcription factor
Regulator family:	HxlR
Regulation mode:	activator
Biological process:	Multidrug resistance
Effector:
Phylum:	Firmicutes
Propagated regulon:
Target genome	Lysinibacillus sphaericus C3-41
Orthologous TF(s)	Bsph_2646
Regulated genes	2

Built upon 21 sites [see more]

Predicted regulatory interactions in *Lysinibacillus sphaericus C3-41*
	Locus tag	Position	Score	Sequence
Position: -40 Score: 6.2 Sequence: TAGTATCAATTTGTATACTA Locus tag: Bsph_2646
	Bsph_2646	-40	6.2	TAGTATCAATTTGTATACTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: yybR
Ortholog function: Transcriptional regulator, HxlR family
Bacillus amyloliquefaciens FZB42	RBAM_037620	-33	6	TAGTATCAAAAAAGGTACTA
Bacillus cereus ATCC 14579	BC3320	-42	6.3	TAGTATCAAAAAAGATACTA
Bacillus halodurans C-125	BH0737	-49	5.2	TAGTTACATGTAGGTTACTA
Bacillus subtilis subsp. subtilis str. 168	BSU05290	-35	6.2	TAGTATCAAAAAGTATACTA
Bacillus subtilis subsp. subtilis str. 168	BSU40540	-34	6	TAGTATCAAAAAAGGTACTA
Paenibacillus sp. JDR-2	Pjdr2_4452	-72	6	TAGTATTAAAAAGGATACTA

Position: -91 Score: 6.2 Sequence: TAGTATACAAATTGATACTA Locus tag: Bsph_2647
	Bsph_2647	-91	6.2	TAGTATACAAATTGATACTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: BH0738
Ortholog function: Zinc-containing alcohol dehydrogenase / Quinone oxidoreductase ( NADPH:quinone reductase)
Bacillus halodurans C-125	BH0738	-101	5.2	TAGTAACCTACATGTAACTA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --