Propagation of FadR regulog to Lysinibacillus sphaericus C3-41
| Source regulog: | FadR - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Fatty acid degradation |
| Effector: | Palmitoyl-CoA; Oleoyl-CoA |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Lysinibacillus sphaericus C3-41 |
| Orthologous TF(s) | Bsph_4063 |
| Regulated genes | 3 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -44
Score: 6.3 Sequence: ATGAATGGCTATTCATTCAA
Locus tag: Bsph_0533
|
||||
| Bsph_0533 | -44 | 6.3 | ATGAATGGCTATTCATTCAA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: fadN | ||||
| Ortholog function: Enoyl-CoA hydratase (EC 4.2.1.17) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) | ||||
| Bacillus subtilis subsp. subtilis str. 168 | BSU32840 | 39 | 6.7 | ATGAATGACTATTCATTCAA |
| Bacillus amyloliquefaciens FZB42 | RBAM_029920 | -39 | 6.7 | ATGAATGACTATTCATTCAA |
| Bacillus pumilus SAFR-032 | BPUM_2942 | -39 | 6.5 | ATGAATGACTGTTCATTCAA |
| Bacillus licheniformis DSM 13 | BLi03466 | -39 | 6.8 | ATGAATGAGTATTCATTCAA |
| Geobacillus kaustophilus HTA426 | GK3008 | -40 | 6.5 | ATGAATGACCATTCATTCAA |
| Bacillus cereus ATCC 14579 | BC5004 | -38 | 6.5 | TTGAATGAGCATTCATTCAA |
| Bacillus halodurans C-125 | BH3488 | -36 | 6.5 | ATGAATGAGTATTCATTCGT |
| Bacillus clausii KSM-K16 | ABC2990 | -46 | 5.9 | ATGAATGAGTGTTCATTCGG |
| Oceanobacillus iheyensis HTE831 | OB2395 | -41 | 6.6 | ATGAATGAGCATTCATTCAA |
|
Position: -42
Score: 5.8 Sequence: TTTAATGAATAACCATTCAT
Locus tag: Bsph_1312
|
||||
| Bsph_1312 | -42 | 5.8 | TTTAATGAATAACCATTCAT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: ykuF | ||||
| Ortholog function: 2,4-dienoyl-CoA reductase, mitochondrial precursor (EC 1.3.1.34) | ||||
| Bacillus subtilis subsp. subtilis str. 168 | BSU14060 | -36 | 6.4 | TTGAATGAATAATCATTCAC |
| Bacillus amyloliquefaciens FZB42 | RBAM_013850 | -40 | 6.8 | ATGAATGATTATTCATTCAA |
| Bacillus pumilus SAFR-032 | BPUM_1303 | -40 | 6.7 | ATGAATGAATAGTCATTCAA |
| Bacillus licheniformis DSM 13 | BLi01620 | -36 | 6.8 | TTGAATGAATACTCATTCAT |
| Anoxybacillus flavithermus WK1 | Aflv_1909 | -37 | 6.5 | ATGAATGAATAACCATTCAT |
| Geobacillus kaustophilus HTA426 | GK1044 | -34 | 6.5 | ATGAATGAGTAATCAGTCAT |
| Bacillus cereus ATCC 14579 | BC3990 | -29 | 5.2 | ATGAATGTGTATTCATTTTT |
| Bacillus halodurans C-125 | BH2144 | -38 | 6.8 | TTGAATGAATATTCATTCAA |
|
Position: -59
Score: 6.3 Sequence: ATGAATGAATGACCATTCAT
Locus tag: Bsph_4063
|
||||
| Bsph_4063 | -59 | 6.3 | ATGAATGAATGACCATTCAT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: fadR | ||||
| Ortholog function: Transcriptional regulator of fatty acids degradation, TetR family | ||||
| Bacillus subtilis subsp. subtilis str. 168 | BSU28550 | -44 | 6.9 | ATGAATGAATAGTCATTCAT |
| Bacillus amyloliquefaciens FZB42 | RBAM_025610 | -38 | 6.9 | ATGAATGAATAGTCATTCAT |
| Bacillus pumilus SAFR-032 | BPUM_2512 | -41 | 6.8 | ATGAATGAATACTCATTCAA |
| Bacillus licheniformis DSM 13 | BLi03002 | -43 | 6.9 | ATGAATGAGTATTCATTCAT |
| Anoxybacillus flavithermus WK1 | Aflv_0565 | -44 | 6.9 | ATGAATGATTATTCATTCAT |
| Geobacillus kaustophilus HTA426 | GK2689 | -60 | 6.1 | ATGAATGATGGTTCATTCAT |
| Bacillus cereus ATCC 14579 | BC4525 | -45 | 6.6 | ATGAATGACTATTCATTCAG |
| Bacillus halodurans C-125 | BH3102 | -38 | 6.9 | ATGAATGAATACTCATTCAT |
| Bacillus clausii KSM-K16 | ABC2672 | -45 | 6.8 | ATGAATGAACATTCATTCAT |
| Oceanobacillus iheyensis HTE831 | OB2121 | -50 | 5.9 | ATGAATGATCATTCACTCAG |