Propagation of HisR regulog to Lysinibacillus sphaericus C3-41

Reference regulog properties
Source regulog:	HisR - Bacillales
Regulator type:	Transcription factor
Regulator family:	TrpR
Regulation mode:	repressor
Biological process:	Histidine biosynthesis
Effector:	Histidine
Phylum:	Firmicutes
Propagated regulon:
Target genome	Lysinibacillus sphaericus C3-41
Orthologous TF(s)	Bsph_0223
Regulated genes	1

Built upon 20 sites [see more]

Predicted regulatory interactions in *Lysinibacillus sphaericus C3-41*
	Locus tag	Position	Score	Sequence
Position: -54 Score: 4.9 Sequence: TACTCTAGTGAATTAAAGTG Locus tag: Bsph_0438
	Bsph_0438	-54	4.9	TACTCTAGTGAATTAAAGTG
Supported by regulated orthologs from reference regulons
Ortholog gene name: hisZ
Ortholog function: ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17)
Bacillus subtilis subsp. subtilis str. 168	BSU34930	-65	5.3	CATATTAGCGAACTAAAGGA
Bacillus amyloliquefaciens FZB42	RBAM_032140	-61	5.3	CATATTAGCGAACTAAAGGA
Bacillus pumilus SAFR-032	BPUM_3128	-62	5.3	CATATTAGCGAACTAAAGGA
Bacillus licheniformis DSM 13	BLi03738	-62	5.5	CATATTAGCGAACTAAAGTA
Anoxybacillus flavithermus WK1	Aflv_2537	-55	4.9	AACTTTACTTTGCTAATATA
		-39	5.6	TATATTAGCGAACTAAAGTA
Geobacillus kaustophilus HTA426	GK3077	-42	5.4	CATATTAGCAAACTAAAGCA
Bacillus halodurans C-125	BH3584	-71	4.3	TCCTTTATCTTGTTAGTATA
		-55	5.6	TATATTAGCGAACTAAAGTA
Bacillus clausii KSM-K16	ABC3050	-43	5.6	TGATTTAGCAAACTAAAGTA
Oceanobacillus iheyensis HTE831	OB0553	-66	4.8	AACTTTACTTAGATAAAGTG
Paenibacillus sp. JDR-2	Pjdr2_0159	-37	5.6	CACTTTAATATACTAAAGTA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --