Propagation of NiaR regulog to Lysinibacillus sphaericus C3-41

Reference regulog properties
Source regulog:	NiaR - Bacillales
Regulator type:	Transcription factor
Regulator family:	NiaR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Niacin
Phylum:	Firmicutes
Propagated regulon:
Target genome	Lysinibacillus sphaericus C3-41
Orthologous TF(s)	Bsph_3941
Regulated genes	2

Built upon 26 sites [see more]

Predicted regulatory interactions in *Lysinibacillus sphaericus C3-41*
	Locus tag	Position	Score	Sequence
Position: -86 Score: 5.5 Sequence: TACAGTTGTCTTGACAATTATC Locus tag: Bsph_4288
	Bsph_4288	-86	5.5	TACAGTTGTCTTGACAATTATC
Supported by regulated orthologs from reference regulons
Ortholog gene name: nifS
Ortholog function: Cysteine desulfurase (EC 2.8.1.7)
Bacillus subtilis subsp. subtilis str. 168	BSU27880	-83	6.5	TACACCTGTCTTGACACCTATA
Bacillus amyloliquefaciens FZB42	RBAM_024930	-84	6.5	TACACCTGTCTTGACACCTATA
Bacillus licheniformis DSM 13	BLi02915	-80	6.6	TACATGTGTCTTGACACCTATA
Anoxybacillus flavithermus WK1	Aflv_0702	-41	5.5	TCATACTGTCTTGACACCTATA
		-29	4.4	GACACCTATATTGACATATATT
Geobacillus kaustophilus HTA426	GK2602	-86	6.1	TTCACCTGTCTTGACATCTATA
Bacillus cereus ATCC 14579	BC4424	-127	6.2	TCCAACTGTCTTGACACCTATA
Bacillus halodurans C-125	BH1217	-102	6.4	TACATATGTCTTGACATCTATA
Bacillus clausii KSM-K16	ABC1546	-73	6.1	TACAGTTGTCTTGTCACCTATA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --