Propagation of IdnR regulog to Dickeya dadantii Ech703

Reference regulog properties
Source regulog:	IdnR - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	activator (repressor)
Biological process:	Idonate utilization
Effector:	L-idonate; 5-dehydro-D-gluconate
Phylum:	Proteobacteria/Gamma
Propagated regulon:
Target genome	Dickeya dadantii Ech703
Orthologous TF(s)	Dd703_0224
Regulated genes	1

Built upon 7 sites [see more]

Predicted regulatory interactions in *Dickeya dadantii Ech703*
	Locus tag	Position	Score	Sequence
Position: -129 Score: 6 Sequence: TCACGTTATGCGTAACATGT Locus tag: Dd703_0221
	Dd703_0221	-129	6	TCACGTTATGCGTAACATGT
Supported by regulated orthologs from reference regulons
Ortholog gene name: idnD
Ortholog function: L-idonate 5-dehydrogenase (EC 1.1.1.264)
Escherichia coli str. K-12 substr. MG1655	b4267	-117	5.9	TCACGTTATGCGTAACATAG
Salmonella typhimurium LT2	STM4484	-117	5.9	TCACGTTATGCGTAACATTG
Serratia proteamaculans 568	Spro_3287	-121	5.1	TCACGTTAAAGGTAACAGCT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --