Propagation of LacI regulog to Shigella dysenteriae Sd197
Source regulog: | LacI - Enterobacteriales |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Lactose utilization |
Effector: | Allolactose |
Phylum: | Proteobacteria/gamma |
Propagated regulon: | |
Target genome | Shigella dysenteriae Sd197 |
Orthologous TF(s) | SDY_0379 |
Regulated genes | 1 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -204
Score: 7.4 Sequence: AATTGTGAGCGGATAACAATT
Locus tag: SDY_0378
|
||||
SDY_0378 | -204 | 7.4 | AATTGTGAGCGGATAACAATT | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: lacZ | ||||
Ortholog function: Beta-galactosidase (EC 3.2.1.23) | ||||
Escherichia coli str. K-12 substr. MG1655 | b0344 | -38 | 7.4 | AATTGTGAGCGGATAACAATT |
Citrobacter koseri ATCC BAA-895 | CKO_02825 | -38 | 7 | AATTGTGAGCGAATAACAAAC |
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_pKPN3p05871 | -37 | 7.2 | AAATGTGAGCGGATAACAATT |
Enterobacter sp. 638 | Ent638_0928 | -29 | 6.3 | AATTGTGAGCGCTTCGCAAAG |
Erwinia carotovora subsp. atroseptica SCRI1043 | ECA1490 | -73 | 7.4 | AATTGTGAGCGGATAACAATT |