Propagation of CzrA regulog to Bacillus coahuilensis m4-4
| Source regulog: | CzrA - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | ArsR |
| Regulation mode: | repressor |
| Biological process: | Zinc resistance; Nickel resistance; Copper resistance; Cobalt resistance; Cadmium resistance |
| Effector: | Zinc ion, (Zn2+); Silver ion, (Ag+); Nickel ion, (Ni2+); Copper ion, (Cu2+); Cobalt ion, (Co2+); Cadmium, ion (Cd2+) |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Bacillus coahuilensis m4-4 |
| Orthologous TF(s) | Bcoam_010100018922 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -41
Score: 7 Sequence: TATATGAATATGTGTTCATATA
Locus tag: Bcoam_010100018922
|
||||
| Bcoam_010100018922 | -41 | 7 | TATATGAATATGTGTTCATATA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: czrA | ||||
| Ortholog function: Transcriptional repressor of multiple metal-sensing, ArsR family | ||||
| Anoxybacillus flavithermus WK1 | Aflv_1335 | -41 | 7.2 | TATATGAACATATATTCATATA |
| Geobacillus kaustophilus HTA426 | GK1406 | -43 | 7.1 | TATATGAACAAATGCTCATATA |
| Geobacillus kaustophilus HTA426 | GK0580 | -48 | 7 | CATATGAACATATGCTCATATA |
| Bacillus clausii KSM-K16 | ABC3390 | -36 | 6.8 | AATATGAACATATAATCATATA |
| Oceanobacillus iheyensis HTE831 | OB1400 | -39 | 6.7 | AATATGAGCATATGATCATATT |