Propagation of IdnR regulog to Salmonella enterica subsp. enterica serovar Newport str. SL254

Reference regulog properties
Source regulog:	IdnR - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	activator (repressor)
Biological process:	Idonate utilization
Effector:	L-idonate; 5-dehydro-D-gluconate
Phylum:	Proteobacteria/Gamma
Propagated regulon:
Target genome	Salmonella enterica subsp. enterica serovar Newport str. SL254
Orthologous TF(s)	SNSL254_A4829
Regulated genes	2

Built upon 7 sites [see more]

Predicted regulatory interactions in *Salmonella enterica subsp. enterica serovar Newport str. SL254*
	Locus tag	Position	Score	Sequence
Position: -117 Score: 5.9 Sequence: TCACGTTATGCGTAACATTG Locus tag: SNSL254_A4832
	SNSL254_A4832	-117	5.9	TCACGTTATGCGTAACATTG
Supported by regulated orthologs from reference regulons
Ortholog gene name: idnD
Ortholog function: L-idonate 5-dehydrogenase (EC 1.1.1.264)
Escherichia coli str. K-12 substr. MG1655	b4267	-117	5.9	TCACGTTATGCGTAACATAG
Salmonella typhimurium LT2	STM4484	-117	5.9	TCACGTTATGCGTAACATTG
Serratia proteamaculans 568	Spro_3287	-121	5.1	TCACGTTAAAGGTAACAGCT

Position: -119 Score: 5.9 Sequence: CAATGTTACGCATAACGTGA Locus tag: SNSL254_A4833
	SNSL254_A4833	-119	5.9	CAATGTTACGCATAACGTGA
Supported by regulated orthologs from reference regulons
Ortholog gene name: idnK
Ortholog function: Gluconokinase (EC 2.7.1.12)
Escherichia coli str. K-12 substr. MG1655	b4268	-119	5.9	CTATGTTACGCATAACGTGA
Salmonella typhimurium LT2	STM4485	-119	5.9	CAATGTTACGCATAACGTGA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --