Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of Zur regulog to Bacillus coahuilensis m4-4

Reference regulog properties
Source regulog: Zur - Bacillales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Firmicutes
Propagated regulon:
Target genome Bacillus coahuilensis m4-4
Orthologous TF(s) Bcoam_010100013329
Regulated genes 2
Built upon 67 sites [see more]
Predicted regulatory interactions in Bacillus coahuilensis m4-4
Locus tag Position Score Sequence
Position: -99
Score: 6
Sequence: ATAATCGTAATCATTACGGTTTA
Locus tag: Bcoam_010100013719
Bcoam_010100013719 -99 6 ATAATCGTAATCATTACGGTTTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: rpsN2
Ortholog function: 30S ribosomal protein S14
Bacillus subtilis subsp. subtilis str. 168 BSU08880 -40 6.6 TAAATCGTAACAATTTCGATTTA
Bacillus amyloliquefaciens FZB42 RBAM_009150 -37 6.7 CAAAACGTAATTATTACGATTTG
Bacillus pumilus SAFR-032 BPUM_3312 -69 6.6 CAAATCGTAATCATTACTTTTTA
Bacillus licheniformis DSM 13 BLi00952 -44 6.7 TAAATCGTAATCATTACGCTTTG
Bacillus clausii KSM-K16 ABC4019 -45 6.1 TAAATCGTAATAATAATGATTTT
Oceanobacillus iheyensis HTE831 OB3432 -247 6 TTAATCGTAATCGTTACGATGTA
© 2009-2020 RegPrecise