Propagation of Zur regulog to Bacillus coahuilensis m4-4
| Source regulog: | Zur - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Bacillus coahuilensis m4-4 |
| Orthologous TF(s) | Bcoam_010100013329 |
| Regulated genes | 2 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -99
Score: 6 Sequence: ATAATCGTAATCATTACGGTTTA
Locus tag: Bcoam_010100013719
|
||||
| Bcoam_010100013719 | -99 | 6 | ATAATCGTAATCATTACGGTTTA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: rpsN2 | ||||
| Ortholog function: 30S ribosomal protein S14 | ||||
| Bacillus subtilis subsp. subtilis str. 168 | BSU08880 | -40 | 6.6 | TAAATCGTAACAATTTCGATTTA |
| Bacillus amyloliquefaciens FZB42 | RBAM_009150 | -37 | 6.7 | CAAAACGTAATTATTACGATTTG |
| Bacillus pumilus SAFR-032 | BPUM_3312 | -69 | 6.6 | CAAATCGTAATCATTACTTTTTA |
| Bacillus licheniformis DSM 13 | BLi00952 | -44 | 6.7 | TAAATCGTAATCATTACGCTTTG |
| Bacillus clausii KSM-K16 | ABC4019 | -45 | 6.1 | TAAATCGTAATAATAATGATTTT |
| Oceanobacillus iheyensis HTE831 | OB3432 | -247 | 6 | TTAATCGTAATCGTTACGATGTA |