Propagation of KdgR regulog to Proteus mirabilis HI4320
| Source regulog: | KdgR - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | IclR |
| Regulation mode: | repressor (activator) |
| Biological process: | Pectin and polygalacturonate utlization |
| Effector: | 2-keto-3-deoxygluconate |
| Phylum: | Proteobacteria/gamma |
| Propagated regulon: | |
| Target genome | Proteus mirabilis HI4320 |
| Orthologous TF(s) | No orthologous TFs found |
| Regulated genes | 3 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -286
Score: 4.6 Sequence: ATACAAAACATAATTTTGTTG
Locus tag: PMI1405
|
||||
| PMI1405 | -286 | 4.6 | ATACAAAACATAATTTTGTTG | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: pykF | ||||
| Ortholog function: Pyruvate kinase (EC 2.7.1.40) | ||||
| Escherichia coli str. K-12 substr. MG1655 | b1676 | -286 | 5 | TTTTGAAACGCTGTTTTTGTT |
| Salmonella typhimurium LT2 | STM1378 | -286 | 4.7 | TTTTGAAACAGGGTTTTCATT |
| Citrobacter koseri ATCC BAA-895 | CKO_01709 | -286 | 5 | TTTTGAAACGCTGTTTTCATT |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_02133 | -285 | 5 | ATTTGAAACGAGGTTTTTATT |
| Enterobacter sp. 638 | Ent638_1768 | -286 | 5.1 | TTTTGAAACGCCGTTTCCATT |
| Serratia proteamaculans 568 | Spro_2187 | -203 | 4.1 | AAtaacAACAcatTTTCATcT |
| Erwinia carotovora subsp. atroseptica SCRI1043 | ECA1867 | -259 | 5.1 | ATACGGAACGTCGTTTCAATT |