Propagation of KdgR regulog to Proteus mirabilis HI4320

Reference regulog properties
Source regulog:	KdgR - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	IclR
Regulation mode:	repressor (activator)
Biological process:	Pectin and polygalacturonate utlization
Effector:	2-keto-3-deoxygluconate
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Proteus mirabilis HI4320
Orthologous TF(s)	No orthologous TFs found
Regulated genes	3

Built upon 159 sites [see more]

Predicted regulatory interactions in *Proteus mirabilis HI4320*
	Locus tag	Position	Score	Sequence
Position: -286 Score: 4.6 Sequence: ATACAAAACATAATTTTGTTG Locus tag: PMI1405
	PMI1405	-286	4.6	ATACAAAACATAATTTTGTTG
Supported by regulated orthologs from reference regulons
Ortholog gene name: pykF
Ortholog function: Pyruvate kinase (EC 2.7.1.40)
Escherichia coli str. K-12 substr. MG1655	b1676	-286	5	TTTTGAAACGCTGTTTTTGTT
Salmonella typhimurium LT2	STM1378	-286	4.7	TTTTGAAACAGGGTTTTCATT
Citrobacter koseri ATCC BAA-895	CKO_01709	-286	5	TTTTGAAACGCTGTTTTCATT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	KPN_02133	-285	5	ATTTGAAACGAGGTTTTTATT
Enterobacter sp. 638	Ent638_1768	-286	5.1	TTTTGAAACGCCGTTTCCATT
Serratia proteamaculans 568	Spro_2187	-203	4.1	AAtaacAACAcatTTTCATcT
Erwinia carotovora subsp. atroseptica SCRI1043	ECA1867	-259	5.1	ATACGGAACGTCGTTTCAATT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --