Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of CelR regulog to Streptococcus pyogenes M49 591

Reference regulog properties
Source regulog: CelR - Streptococcaceae
Regulator type: Transcription factor
Regulator family: BglG
Regulation mode: repressor
Biological process: Cellobiose utilization
Effector: CelB, cellobiose-specific PTS component EIIB; HPr, phosphocarrier protein
Phylum: Firmicutes
Propagated regulon:
Target genome Streptococcus pyogenes M49 591
Orthologous TF(s) SpyoM01000911
Regulated genes 1
Built upon 15 sites [see more]
Predicted regulatory interactions in Streptococcus pyogenes M49 591
Locus tag Position Score Sequence
Position: -100
Score: 5.5
Sequence: TTTCACAATCAATGCGGAAA
Locus tag: SpyoM01000911
SpyoM01000911 -100 5.5 TTTCACAATCAATGCGGAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: celR
Ortholog function: Cellobiose utilization transcriptional regulator CelR, BglG family
Streptococcus dysgalactiae subsp. equisimilis GGS_124 SDEG_1400 -83 5.5 TTGCCGTAGTGCTAAGGAAA
Streptococcus equi subsp. zooepidemicus MGCS10565 Sez_1282 -97 5.3 CTTCACAATCGATACGGAAA
Streptococcus gallolyticus UCN34 GALLO_1212 -93 5.9 TTTCCTTATCAAAGAGGAAA
Streptococcus gordonii str. Challis substr. CH1 SGO_1579 -96 6.3 TTTCCGTTTCGATACGGAAA
Streptococcus mutans UA159 SMU.1599 -92 5.3 TTCCGTTTTCAATACGGAAA
Streptococcus pneumoniae TIGR4 SP_0306 -125 5.7 TTTCCATATCATTTAGGAAA
Streptococcus pyogenes M1 GAS SPy1325 -100 5.5 TTTCACAATCAATGCGGAAA
Streptococcus suis 05ZYH33 SSU05_2076 -100 5.7 TTTCATTAATGATGCGGAAA
Streptococcus uberis 0140J SUB0530 -141 4.8 TTGCTTTTTTAATAGGGAAA
-100 6 TTTCCGCATCATTACGGAAA