Propagation of MdxR regulog to Streptococcus suis 05ZYH33

Reference regulog properties
Source regulog:	MdxR - Streptococcaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	activator
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Phylum:	Firmicutes
Propagated regulon:
Target genome	Streptococcus suis 05ZYH33
Orthologous TF(s)	SSU05_2066
Regulated genes	1

Built upon 1 sites [see more]

Predicted regulatory interactions in *Streptococcus suis 05ZYH33*
	Locus tag	Position	Score	Sequence
Position: -78 Score: 6.4 Sequence: TAAAGAAAACGTTTGCACAA Locus tag: SSU05_2066
	SSU05_2066	-78	6.4	TAAAGAAAACGTTTGCACAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: mdxR
Ortholog function: Predicted maltose/maltodextrin utilization transcriptional regulator MdxR, LacI family
Streptococcus suis 05ZYH33	SSU05_2066	-78	6.4	TAAAGAAAACGTTTGCACAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --