Propagation of MdxR regulog to Streptococcus suis 05ZYH33
Source regulog: | MdxR - Streptococcaceae |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | activator |
Biological process: | Maltose utilization; Maltodextrin utilization |
Effector: | Maltose |
Phylum: | Firmicutes |
Propagated regulon: | |
Target genome | Streptococcus suis 05ZYH33 |
Orthologous TF(s) | SSU05_2066 |
Regulated genes | 1 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -78
Score: 6.4 Sequence: TAAAGAAAACGTTTGCACAA
Locus tag: SSU05_2066
|
||||
SSU05_2066 | -78 | 6.4 | TAAAGAAAACGTTTGCACAA | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: mdxR | ||||
Ortholog function: Predicted maltose/maltodextrin utilization transcriptional regulator MdxR, LacI family | ||||
Streptococcus suis 05ZYH33 | SSU05_2066 | -78 | 6.4 | TAAAGAAAACGTTTGCACAA |