Propagation of YjdR regulog to Streptococcus agalactiae 18RS21

Reference regulog properties
Source regulog:	YjdR - Streptococcaceae
Regulator type:	Transcription factor
Regulator family:	MarR
Regulation mode:
Biological process:	Multidrug resistance
Effector:
Phylum:	Firmicutes
Propagated regulon:
Target genome	Streptococcus agalactiae 18RS21
Orthologous TF(s)	No orthologous TFs found
Regulated genes	1

Built upon 21 sites [see more]

Predicted regulatory interactions in *Streptococcus agalactiae 18RS21*
	Locus tag	Position	Score	Sequence
Position: -144 Score: 6.6 Sequence: ATAGTTCTCACGATAACTAA Locus tag: SAJ_1658
	SAJ_1658	-144	6.6	ATAGTTCTCACGATAACTAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: yjdE
Ortholog function: Predicted drug resistance transporter, EmrB/QacA family
Streptococcus agalactiae 2603V/R	SAG1707	-144	6.6	ATAGTTCTCACGATAACTAA
Streptococcus uberis 0140J	SUB1642	-87	6	ATAGTTCTCAGGGTAACTAT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --