Propagation of MdxR regulog to Streptococcus suis SC84
| Source regulog: | MdxR - Streptococcaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | activator |
| Biological process: | Maltose utilization; Maltodextrin utilization |
| Effector: | Maltose |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Streptococcus suis SC84 |
| Orthologous TF(s) | SSUSC84_1872 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -78
Score: 6.4 Sequence: TAAAGAAAACGTTTGCACAA
Locus tag: SSUSC84_1872
|
||||
| SSUSC84_1872 | -78 | 6.4 | TAAAGAAAACGTTTGCACAA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: mdxR | ||||
| Ortholog function: Predicted maltose/maltodextrin utilization transcriptional regulator MdxR, LacI family | ||||
| Streptococcus suis 05ZYH33 | SSU05_2066 | -78 | 6.4 | TAAAGAAAACGTTTGCACAA |