Propagation of BfrR regulog to Lactobacillus crispatus ST1

Reference regulog properties
Source regulog:	BfrR - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Fructooligosaccharides utilization
Effector:
Phylum:	Firmicutes
Propagated regulon:
Target genome	Lactobacillus crispatus ST1
Orthologous TF(s)	LCRIS_00497
Regulated genes	1

Built upon 1 sites [see more]

Predicted regulatory interactions in *Lactobacillus crispatus ST1*
	Locus tag	Position	Score	Sequence
Position: -93 Score: 6.5 Sequence: AAATTGAAACGTTTCAATAA Locus tag: LCRIS_00498
	LCRIS_00498	-93	6.5	AAATTGAAACGTTTCAATAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: bfrE
Ortholog function: Fructooligosaccharides ABC transporter, substrate-binding protein
Lactobacillus acidophilus NCFM	LBA0502	-28	6.4	AAATTGAAACGTTTCAAAAG

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --