Propagation of BfrR regulog to Lactobacillus crispatus ST1
| Source regulog: | BfrR - Lactobacillaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Fructooligosaccharides utilization |
| Effector: | |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Lactobacillus crispatus ST1 |
| Orthologous TF(s) | LCRIS_00497 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -93
Score: 6.5 Sequence: AAATTGAAACGTTTCAATAA
Locus tag: LCRIS_00498
|
||||
| LCRIS_00498 | -93 | 6.5 | AAATTGAAACGTTTCAATAA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: bfrE | ||||
| Ortholog function: Fructooligosaccharides ABC transporter, substrate-binding protein | ||||
| Lactobacillus acidophilus NCFM | LBA0502 | -28 | 6.4 | AAATTGAAACGTTTCAAAAG |