Propagation of Zur regulog to Lactobacillus sakei subsp. sakei 23K

Reference regulog properties
Source regulog:	Zur - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Phylum:	Firmicutes
Propagated regulon:
Target genome	Lactobacillus sakei subsp. sakei 23K
Orthologous TF(s)	LSA0109
Regulated genes	1

Built upon 43 sites [see more]

Predicted regulatory interactions in *Lactobacillus sakei subsp. sakei 23K*
	Locus tag	Position	Score	Sequence
Position: -37 Score: 6.5 Sequence: TAAAGCGTAACTATTACGATTTA Locus tag: LSA0282
	LSA0282	-37	6.5	TAAAGCGTAACTATTACGATTTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: znuA
Ortholog function: Zinc ABC transporter, substrate-binding protein
Lactobacillus brevis ATCC 367	LVIS_0470	-46	6.6	TAAACGGTAATCATTACTGTTTA
Lactobacillus plantarum WCFS1	lp_3302	-44	6.6	TTAACAGTAATGGTTACGATTTA
Lactobacillus sakei subsp. sakei 23K	LSA0282	-37	6.5	TAAAGCGTAACTATTACGATTTA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --