Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of CopR regulog to Oenococcus oeni PSU-1

Reference regulog properties
Source regulog: CopR - Lactobacillaceae
Regulator type: Transcription factor
Regulator family: CopY
Regulation mode: repressor
Biological process: Copper homeostasis
Effector: Copper ion, (Cu2+)
Phylum: Firmicutes
Propagated regulon:
Target genome Oenococcus oeni PSU-1
Orthologous TF(s) OEOE_1648
Regulated genes 1
Built upon 34 sites [see more]
Predicted regulatory interactions in Oenococcus oeni PSU-1
Locus tag Position Score Sequence
Position: -30
Score: 5.8
Sequence: AAGTCTACAAGTGTAGACTA
Locus tag: OEOE_1648
OEOE_1648 -30 5.8 AAGTCTACAAGTGTAGACTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: copR
Ortholog function: Copper transport transcriptional regulator CopR, CopY family
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 LEUM_0049 -25 5.9 TAGTTTACAGTTGTAGACTA
Oenococcus oeni PSU-1 OEOE_1648 -30 5.8 AAGTCTACAAGTGTAGACTA
© 2009-2020 RegPrecise