Propagation of CopR regulog to Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Reference regulog properties
Source regulog:	CopR - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	CopY
Regulation mode:	repressor
Biological process:	Copper homeostasis
Effector:	Copper ion, (Cu2+)
Phylum:	Firmicutes
Propagated regulon:
Target genome	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
Orthologous TF(s)	LBUL_0587
Regulated genes	1

Built upon 34 sites [see more]

Predicted regulatory interactions in *Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365*
	Locus tag	Position	Score	Sequence
Position: -31 Score: 6 Sequence: AAGGTTATAGATGTAAACGA Locus tag: LBUL_0587
	LBUL_0587	-31	6	AAGGTTATAGATGTAAACGA
Supported by regulated orthologs from reference regulons
Ortholog gene name: copR
Ortholog function: Copper transport transcriptional regulator CopR, CopY family
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365	LBUL_0587	-72	4.8	TTGTCGACAAATGTAAACCA
		-31	6	AAGGTTATAGATGTAAACGA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --