Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of NiaR regulog to Lactobacillus casei ATCC 334

Reference regulog properties
Source regulog: NiaR - Lactobacillaceae
Regulator type: Transcription factor
Regulator family: NiaR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Niacin
Phylum: Firmicutes
Propagated regulon:
Target genome Lactobacillus casei ATCC 334
Orthologous TF(s) LSEI_0807
Regulated genes 1
Built upon 7 sites [see more]
Predicted regulatory interactions in Lactobacillus casei ATCC 334
Locus tag Position Score Sequence
Position: -45
Score: 5
Sequence: CTAGGGTGTCAAGACACCCTAA
Locus tag: LSEI_2277
LSEI_2277 -45 5 CTAGGGTGTCAAGACACCCTAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: niaP
Ortholog function: Niacin transporter NiaP
Lactobacillus casei ATCC 334 LSEI_2277 -45 5 CTAGGGTGTCAAGACACCCTAA
Lactobacillus rhamnosus GG LGG_02281 -51 5.6 TTAGGGTGTCAAGACACCTAAT
Lactobacillus sakei subsp. sakei 23K LSA1529 -76 5.9 TTAAGGTGTGTTGACACCTGTA
Pediococcus pentosaceus ATCC 25745 PEPE_0213 -112 5.6 TACAAGTGTCAAGACATTAATT