Propagation of MntR regulog to Lactobacillus plantarum WCFS1

Reference regulog properties
Source regulog:	MntR - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Phylum:	Firmicutes
Propagated regulon:
Target genome	Lactobacillus plantarum WCFS1
Orthologous TF(s)	lp_0996
Regulated genes	2

Built upon 14 sites [see more]

Predicted regulatory interactions in *Lactobacillus plantarum WCFS1*
	Locus tag	Position	Score	Sequence
Position: -82 Score: 5.2 Sequence: AAGTTAACTGCACCTAACAA Locus tag: lp_1095
	lp_1095	-82	5.2	AAGTTAACTGCACCTAACAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: mntC
Ortholog function: Manganese ABC transporter, permease protein
Lactobacillus casei ATCC 334	LSEI_2423	-32	5.7	GAATTAGGTCACCCTAAAAA
Lactobacillus plantarum WCFS1	lp_1095	-82	5.2	AAGTTAACTGCACCTAACAA
Lactobacillus rhamnosus GG	LGG_02421	-31	5.6	GAATTAGGTCACCCTAAAAT
Lactobacillus sakei subsp. sakei 23K	LSA0180	-34	6.3	AAGTTAGGTATACCTAAAAG

Position: -98 Score: 5.3 Sequence: TTTGTAGGCATACCTAAAAA Locus tag: lp_2992
	lp_2992	-98	5.3	TTTGTAGGCATACCTAAAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: mntH
Ortholog function: Manganese transport protein MntH
Lactobacillus plantarum WCFS1	lp_2992	-98	5.3	TTTGTAGGCATACCTAAAAA
Lactobacillus sakei subsp. sakei 23K	LSA0246	7	5.5	AAGTTAAGGGACCCAAAAAG

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --