Propagation of AraR regulog to Lactobacillus plantarum WCFS1
| Source regulog: | AraR - Lactobacillaceae |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Arabinose utilization |
| Effector: | Arabinose |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Lactobacillus plantarum WCFS1 |
| Orthologous TF(s) | lp_3558 |
| Regulated genes | 2 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -234
Score: 5.2 Sequence: TTATTGATGCGGATAAATTG
Locus tag: lp_3558
|
||||
| lp_3558 | -234 | 5.2 | TTATTGATGCGGATAAATTG | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: araR | ||||
| Ortholog function: Arabinoside utilization transcriptional repressor AraR, GntR family | ||||
| Lactobacillus fermentum IFO 3956 | LAF_1556 | -77 | 5.9 | TGATTTATACGGACAAAAAA |
| Lactobacillus plantarum WCFS1 | lp_3558 | -234 | 5.2 | TTATTGATGCGGATAAATTG |