Propagation of AraR regulog to Lactobacillus plantarum WCFS1

Reference regulog properties
Source regulog:	AraR - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Arabinose utilization
Effector:	Arabinose
Phylum:	Firmicutes
Propagated regulon:
Target genome	Lactobacillus plantarum WCFS1
Orthologous TF(s)	lp_3558
Regulated genes	2

Built upon 18 sites [see more]

Predicted regulatory interactions in *Lactobacillus plantarum WCFS1*
	Locus tag	Position	Score	Sequence
Position: -234 Score: 5.2 Sequence: TTATTGATGCGGATAAATTG Locus tag: lp_3558
	lp_3558	-234	5.2	TTATTGATGCGGATAAATTG
Supported by regulated orthologs from reference regulons
Ortholog gene name: araR
Ortholog function: Arabinoside utilization transcriptional repressor AraR, GntR family
Lactobacillus fermentum IFO 3956	LAF_1556	-77	5.9	TGATTTATACGGACAAAAAA
Lactobacillus plantarum WCFS1	lp_3558	-234	5.2	TTATTGATGCGGATAAATTG

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --