Propagation of FlpA regulog to Pediococcus pentosaceus ATCC 25745
| Source regulog: | FlpA - Lactobacillaceae |
| Regulator type: | Transcription factor |
| Regulator family: | CRP |
| Regulation mode: | activator (repressor) |
| Biological process: | Heavy metal resistance |
| Effector: | Oxygen |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Pediococcus pentosaceus ATCC 25745 |
| Orthologous TF(s) | PEPE_0408 |
| Regulated genes | 2 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -74
Score: 5.7 Sequence: AAATTGACGTAGGTCAATTT
Locus tag: PEPE_0408
|
||||
| PEPE_0408 | -74 | 5.7 | AAATTGACGTAGGTCAATTT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: flpA | ||||
| Ortholog function: Heavy metal resistance transcriptional regulator FlpA, Crp family | ||||
| Lactobacillus plantarum WCFS1 | lp_3444 | -142 | 6 | AACTTGACGGCCGTCAAGAA |
| Oenococcus oeni PSU-1 | OEOE_0355 | -142 | 6 | AACTTGACGGCCGTCAAGAA |
| Pediococcus pentosaceus ATCC 25745 | PEPE_0408 | -74 | 5.7 | AAATTGACGTAGGTCAATTT |
|
Position: -75
Score: 5.7 Sequence: AAATTGACCTACGTCAATTT
Locus tag: PEPE_0409
|
||||
| PEPE_0409 | -75 | 5.7 | AAATTGACCTACGTCAATTT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: copZ | ||||
| Ortholog function: Copper chaperone | ||||
| Lactobacillus acidophilus NCFM | LBA0542 | -81 | 6 | AAATTGACGATCATCAAGTT |
| Lactobacillus casei ATCC 334 | LSEI_0071 | -76 | 5.4 | AACTTGACGACGATCAAGGA |
| Lactobacillus fermentum IFO 3956 | LAF_1701 | -68 | 5.1 | AAGTTGATGAGGATCAATTA |
| Lactobacillus johnsonii NCC 533 | LJ1695 | -82 | 6 | AAATTGACGATCATCAAGTT |
| Lactobacillus plantarum WCFS1 | lp_3442 | -75 | 6 | TTCTTGACGGCCGTCAAGTT |
| Lactobacillus reuteri JCM 1112 | LAR_1340 | -69 | 5.7 | AAATTGATGATAATCAATTT |
| Lactobacillus rhamnosus GG | LGG_00083 | -76 | 6 | AACTTGACGGCCATCAAGGT |
| Lactobacillus sakei subsp. sakei 23K | LSA1783 | -79 | 6.1 | AACTTGATGGCGATCAATTT |
| Lactobacillus salivarius subsp. salivarius UCC118 | LSL_1784 | -129 | 5.9 | AACTTGATATGCGTCAATTT |
| Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 | LEUM_A04 | -66 | 5.2 | TAATTGATCTATATCAAGTA |
| Oenococcus oeni PSU-1 | OEOE_0354 | -126 | 6 | TTCTTGACGGCCGTCAAGTT |
| Pediococcus pentosaceus ATCC 25745 | PEPE_0409 | -75 | 5.7 | AAATTGACCTACGTCAATTT |