Propagation of Lp_2742 regulog to Pediococcus pentosaceus ATCC 25745
| Source regulog: | Lp_2742 - Lactobacillaceae |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Multidrug efflux; Multidrug resistance |
| Effector: | |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Pediococcus pentosaceus ATCC 25745 |
| Orthologous TF(s) | PEPE_1308 |
| Regulated genes | 2 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -61
Score: 6.3 Sequence: TTAGTTACATGACTAATTAA
Locus tag: PEPE_1308
|
||||
| PEPE_1308 | -61 | 6.3 | TTAGTTACATGACTAATTAA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: lp_2742 | ||||
| Ortholog function: Transcriptional regulator, GntR family | ||||
| Lactobacillus brevis ATCC 367 | LVIS_0389 | -46 | 6.7 | TTAATTACACAAGTAACTAA |
| Lactobacillus fermentum IFO 3956 | LAF_1400 | -48 | 6.7 | TTAGTTACACAAGTAATTAA |
| Lactobacillus plantarum WCFS1 | lp_2742 | -59 | 6.8 | TTAGTTACATAAGTAATTAA |
| Lactobacillus reuteri JCM 1112 | LAR_1262 | -48 | 6.5 | TTAGTTACATAAGTGATTAA |
| Lactobacillus salivarius subsp. salivarius UCC118 | LSL_1617 | -52 | 6.8 | TTAGTTACATAAGTAATTAA |
| Pediococcus pentosaceus ATCC 25745 | PEPE_1308 | -61 | 6.3 | TTAGTTACATGACTAATTAA |
|
Position: -42
Score: 6.7 Sequence: TTAGTTACACAAGTAATTAA
Locus tag: PEPE_1743
|
||||
| PEPE_1743 | -42 | 6.7 | TTAGTTACACAAGTAATTAA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: lp_2739 | ||||
| Ortholog function: Predicted antimicrobial peptide ABC transporter, ATP-binding protein | ||||
| Lactobacillus brevis ATCC 367 | LVIS_0387 | -46 | 6.7 | TTAATTACACAAGTAACTAA |
| Lactobacillus plantarum WCFS1 | lp_2739 | -59 | 6.8 | TTAGTTACATAAGTAATTAA |
| Pediococcus pentosaceus ATCC 25745 | PEPE_1743 | -42 | 6.7 | TTAGTTACACAAGTAATTAA |