Propagation of MalR regulog to Pediococcus pentosaceus ATCC 25745

Reference regulog properties
Source regulog:	MalR - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Phylum:	Firmicutes
Propagated regulon:
Target genome	Pediococcus pentosaceus ATCC 25745
Orthologous TF(s)	PEPE_0969
Regulated genes	1

Built upon 11 sites [see more]

Predicted regulatory interactions in *Pediococcus pentosaceus ATCC 25745*
	Locus tag	Position	Score	Sequence
Position: -86 Score: 6.1 Sequence: AAGTGCAAACGCTTGCACAA Locus tag: PEPE_0968
	PEPE_0968	-86	6.1	AAGTGCAAACGCTTGCACAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: malT
Ortholog function: Predicted maltose/maltodextrin permease
Lactobacillus brevis ATCC 367	LVIS_0357	-93	6.2	TTGCGCAATCGGTTGCATTA
Lactobacillus fermentum IFO 3956	LAF_0024	-122	6.6	TTGTGCAAACGGTTGCACAA
Lactobacillus reuteri JCM 1112	LAR_0051	-124	6	TTGCGCAAGCGGTTGCGCAA
Lactobacillus salivarius subsp. salivarius UCC118	LSL_1282	-117	6.3	TATCGCAAACGGTTGCAAAA
Pediococcus pentosaceus ATCC 25745	PEPE_0968	-86	6.1	AAGTGCAAACGCTTGCACAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --