Propagation of MntR regulog to Lactobacillus rhamnosus GG
| Source regulog: | MntR - Lactobacillaceae |
| Regulator type: | Transcription factor |
| Regulator family: | DtxR |
| Regulation mode: | repressor |
| Biological process: | Manganese homeostasis |
| Effector: | Manganese ion, (Mn2+) |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Lactobacillus rhamnosus GG |
| Orthologous TF(s) | LGG_00759 |
| Regulated genes | 2 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -72
Score: 6.4 Sequence: AAGTTAGGGAGACCTAAAAG
Locus tag: LGG_02411
|
||||
| LGG_02411 | -72 | 6.4 | AAGTTAGGGAGACCTAAAAG | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: mntH | ||||
| Ortholog function: Manganese transport protein MntH | ||||
| Lactobacillus brevis ATCC 367 | LVIS_0225 | -19 | 5 | AAGGAAGGGAGTCTTAAAAT |
| Lactobacillus casei ATCC 334 | LSEI_2413 | -71 | 6.4 | AAGTTAGGGAGACCTAAAAG |
| Lactobacillus fermentum IFO 3956 | LAF_1828 | -91 | 4.8 | TTTTTATGCTAACCTAACAA |
| Lactobacillus rhamnosus GG | LGG_02411 | -72 | 6.4 | AAGTTAGGGAGACCTAAAAG |
|
Position: -31
Score: 5.6 Sequence: GAATTAGGTCACCCTAAAAT
Locus tag: LGG_02421
|
||||
| LGG_02421 | -31 | 5.6 | GAATTAGGTCACCCTAAAAT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: mntC | ||||
| Ortholog function: Manganese ABC transporter, permease protein | ||||
| Lactobacillus casei ATCC 334 | LSEI_2423 | -32 | 5.7 | GAATTAGGTCACCCTAAAAA |
| Lactobacillus plantarum WCFS1 | lp_1095 | -82 | 5.2 | AAGTTAACTGCACCTAACAA |
| Lactobacillus rhamnosus GG | LGG_02421 | -31 | 5.6 | GAATTAGGTCACCCTAAAAT |
| Lactobacillus sakei subsp. sakei 23K | LSA0180 | -34 | 6.3 | AAGTTAGGTATACCTAAAAG |