Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of CtsR regulog to Lactobacillus reuteri 100-23

Reference regulog properties
Source regulog: CtsR - Lactobacillaceae
Regulator type: Transcription factor
Regulator family: CtsR
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Firmicutes
Propagated regulon:
Target genome Lactobacillus reuteri 100-23
Orthologous TF(s) Lreu23DRAFT_0151
Regulated genes 1
Built upon 44 sites [see more]
Predicted regulatory interactions in Lactobacillus reuteri 100-23
Locus tag Position Score Sequence
Position: -101
Score: 6.5
Sequence: AATTGTTTGACGTTTCTTGACTTT
Locus tag: Lreu23DRAFT_0489
Lreu23DRAFT_0489 -101 6.5 AATTGTTTGACGTTTCTTGACTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: hrcA
Ortholog function: Heat shock response transcriptional regulator HrcA, HrcA family
Lactobacillus fermentum IFO 3956 LAF_0749 -89 6.4 AGATCTTTGACTTTTGTTGACTTT
Lactobacillus plantarum WCFS1 lp_2029 -91 5.9 AATACTTTGTCTTTCCTTGACTTT
Lactobacillus reuteri JCM 1112 LAR_0677 -101 6.5 AATTGTTTGACGTTTCTTGACTTT
Lactobacillus sakei subsp. sakei 23K LSA1238 -87 5.3 CAATTCTTGACTTTATTTGACGTT
Pediococcus pentosaceus ATCC 25745 PEPE_0894 -107 6 AGATGTCTGACCAAATTTGACTAT
© 2009-2020 RegPrecise