Propagation of CopR regulog to Lactobacillus acidophilus NCFM

Reference regulog properties
Source regulog:	CopR - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	CopY
Regulation mode:	repressor
Biological process:	Copper homeostasis
Effector:	Copper ion, (Cu2+)
Phylum:	Firmicutes
Propagated regulon:
Target genome	Lactobacillus acidophilus NCFM
Orthologous TF(s)	LBA1963
Regulated genes	1

Built upon 34 sites [see more]

Predicted regulatory interactions in *Lactobacillus acidophilus NCFM*
	Locus tag	Position	Score	Sequence
Position: -32 Score: 6.1 Sequence: ATAGTTACATTTGTAAACGA Locus tag: LBA1963
	LBA1963	-32	6.1	ATAGTTACATTTGTAAACGA
Supported by regulated orthologs from reference regulons
Ortholog gene name: copR
Ortholog function: Copper transport transcriptional regulator CopR, CopY family
Lactobacillus acidophilus NCFM	LBA1963	-32	6.1	ATAGTTACATTTGTAAACGA
Lactobacillus helveticus DPC 4571	lhv_2094	-59	5.3	AAGTTTACAAATGTAAAATT
		-32	6.3	ATATTTACAAATGTAAACTA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --