Propagation of YybA regulog to Lactobacillus johnsonii NCC 533

Reference regulog properties
Source regulog:	YybA - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	MarR
Regulation mode:
Biological process:	unknown
Effector:
Phylum:	Firmicutes
Propagated regulon:
Target genome	Lactobacillus johnsonii NCC 533
Orthologous TF(s)	LJ0661
Regulated genes	1

Built upon 2 sites [see more]

Predicted regulatory interactions in *Lactobacillus johnsonii NCC 533*
	Locus tag	Position	Score	Sequence
Position: -67 Score: 7.8 Sequence: TTATTGTCGCATTTGCAACAATAA Locus tag: LJ0661
	LJ0661	-67	7.8	TTATTGTCGCATTTGCAACAATAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: yybA
Ortholog function: Predicted transcriptional regulator, MarR family
Lactobacillus acidophilus NCFM	LBA1663	-51	7.8	TTTTTGTTGCAAATGCAACAAAAA
Lactobacillus johnsonii NCC 533	LJ0661	-67	7.8	TTATTGTCGCATTTGCAACAATAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --