Propagation of CopR regulog to Lactobacillus johnsonii NCC 533

Reference regulog properties
Source regulog:	CopR - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	CopY
Regulation mode:	repressor
Biological process:	Copper homeostasis
Effector:	Copper ion, (Cu2+)
Phylum:	Firmicutes
Propagated regulon:
Target genome	Lactobacillus johnsonii NCC 533
Orthologous TF(s)	LJ1835
Regulated genes	1

Built upon 34 sites [see more]

Predicted regulatory interactions in *Lactobacillus johnsonii NCC 533*
	Locus tag	Position	Score	Sequence
Position: -33 Score: 6.3 Sequence: ATGATTACATTTGTAAACGA Locus tag: LJ1835
	LJ1835	-33	6.3	ATGATTACATTTGTAAACGA
Supported by regulated orthologs from reference regulons
Ortholog gene name: copR
Ortholog function: Copper transport transcriptional regulator CopR, CopY family
Lactobacillus johnsonii NCC 533	LJ1835	-61	5.4	TTGTTGACAAGTGTAAACTA
		-33	6.3	ATGATTACATTTGTAAACGA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --