Propagation of FlpA regulog to Lactobacillus fermentum IFO 3956

Reference regulog properties
Source regulog:	FlpA - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Heavy metal resistance
Effector:	Oxygen
Phylum:	Firmicutes
Propagated regulon:
Target genome	Lactobacillus fermentum IFO 3956
Orthologous TF(s)	LAF_1699, LAF_1464
Regulated genes	2

Built upon 32 sites [see more]

Predicted regulatory interactions in *Lactobacillus fermentum IFO 3956*
	Locus tag	Position	Score	Sequence
Position: -91 Score: 4.8 Sequence: AAGTTGATAGAAAACAATTT Locus tag: LAF_1466
	LAF_1466	-91	4.8	AAGTTGATAGAAAACAATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: copZ
Ortholog function: Copper chaperone
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365	LBUL_0428	-77	5.3	ATCTTGATAGAAATCAATTG
Lactobacillus fermentum IFO 3956	LAF_1466	-91	4.8	AAGTTGATAGAAAACAATTT

Position: -69 Score: 5.2 Sequence: CTCTTGATTCCGATCAATTT Locus tag: LAF_1702
	LAF_1702	-69	5.2	CTCTTGATTCCGATCAATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: cadA
Ortholog function: Lead, cadmium, zinc and mercury transporting ATPase (EC:3.6.3.-)
Lactobacillus acidophilus NCFM	LBA0541	-75	5.4	ATCTTGATAACAGTCAAGTC
Lactobacillus casei ATCC 334	LSEI_0070	-68	4.8	AAGTTGATCACCGTCAAGGC
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365	LBUL_0427	-77	5.3	ATCTTGATAGAAATCAATTG
Lactobacillus fermentum IFO 3956	LAF_1702	-69	5.2	CTCTTGATTCCGATCAATTT
Lactobacillus johnsonii NCC 533	LJ1696	-75	5.2	ATCTTGATAATAGTCAAGTC
Lactobacillus plantarum WCFS1	lp_3435	-78	6.1	AACTTGACGCCTATCAAGTT
Lactobacillus rhamnosus GG	LGG_00082	-68	5.3	AAATTGATCCCGGTCAAGGT
Lactobacillus sakei subsp. sakei 23K	LSA1784	-75	6.3	AACTTGATGGCTATCAAGTT
Lactobacillus salivarius subsp. salivarius UCC118	LSL_1786	-210	5.6	AACTTGATAGCCATAAATTT
		-88	5.7	AACTTGATGTCAGTCAATTA
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293	LEUM_A03	-76	6.3	AACTTGATGGACGTCAAGTT
Pediococcus pentosaceus ATCC 25745	PEPE_0411	-75	5.7	AAATTGACCTACGTCAATTT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --