Propagation of Lp_2742 regulog to Lactobacillus fermentum IFO 3956
Source regulog: | Lp_2742 - Lactobacillaceae |
Regulator type: | Transcription factor |
Regulator family: | GntR/Others |
Regulation mode: | |
Biological process: | Multidrug efflux; Multidrug resistance |
Effector: | |
Phylum: | Firmicutes |
Propagated regulon: | |
Target genome | Lactobacillus fermentum IFO 3956 |
Orthologous TF(s) | LAF_1400 |
Regulated genes | 1 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -48
Score: 6.7 Sequence: TTAGTTACACAAGTAATTAA
Locus tag: LAF_1400
|
||||
LAF_1400 | -48 | 6.7 | TTAGTTACACAAGTAATTAA | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: lp_2742 | ||||
Ortholog function: Transcriptional regulator, GntR family | ||||
Lactobacillus brevis ATCC 367 | LVIS_0389 | -46 | 6.7 | TTAATTACACAAGTAACTAA |
Lactobacillus fermentum IFO 3956 | LAF_1400 | -48 | 6.7 | TTAGTTACACAAGTAATTAA |
Lactobacillus plantarum WCFS1 | lp_2742 | -59 | 6.8 | TTAGTTACATAAGTAATTAA |
Lactobacillus reuteri JCM 1112 | LAR_1262 | -48 | 6.5 | TTAGTTACATAAGTGATTAA |
Lactobacillus salivarius subsp. salivarius UCC118 | LSL_1617 | -52 | 6.8 | TTAGTTACATAAGTAATTAA |
Pediococcus pentosaceus ATCC 25745 | PEPE_1308 | -61 | 6.3 | TTAGTTACATGACTAATTAA |