Propagation of MntR regulog to Lactobacillus fermentum IFO 3956

Reference regulog properties
Source regulog:	MntR - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Phylum:	Firmicutes
Propagated regulon:
Target genome	Lactobacillus fermentum IFO 3956
Orthologous TF(s)	LAF_1543
Regulated genes	1

Built upon 14 sites [see more]

Predicted regulatory interactions in *Lactobacillus fermentum IFO 3956*
	Locus tag	Position	Score	Sequence
Position: -91 Score: 4.8 Sequence: TTTTTATGCTAACCTAACAA Locus tag: LAF_1828
	LAF_1828	-91	4.8	TTTTTATGCTAACCTAACAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: mntH
Ortholog function: Manganese transport protein MntH
Lactobacillus brevis ATCC 367	LVIS_0225	-19	5	AAGGAAGGGAGTCTTAAAAT
Lactobacillus casei ATCC 334	LSEI_2413	-71	6.4	AAGTTAGGGAGACCTAAAAG
Lactobacillus fermentum IFO 3956	LAF_1828	-91	4.8	TTTTTATGCTAACCTAACAA
Lactobacillus rhamnosus GG	LGG_02411	-72	6.4	AAGTTAGGGAGACCTAAAAG

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --