Propagation of NrtR regulog to Lactobacillus fermentum IFO 3956

Reference regulog properties
Source regulog:	NrtR - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	NrtR
Regulation mode:
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Phylum:	Firmicutes
Propagated regulon:
Target genome	Lactobacillus fermentum IFO 3956
Orthologous TF(s)	LAF_1389
Regulated genes	1

Built upon 8 sites [see more]

Predicted regulatory interactions in *Lactobacillus fermentum IFO 3956*
	Locus tag	Position	Score	Sequence
Position: -54 Score: 6 Sequence: TTTAGGTATTTTTTACTTTAA Locus tag: LAF_1390
	LAF_1390	-54	6	TTTAGGTATTTTTTACTTTAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: pncA
Ortholog function: Nicotinamidase (EC 3.5.1.19)
Lactobacillus casei ATCC 334	LSEI_2767	-40	6.3	TTTAAGTAAAAAATACTTTTA
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365	LBUL_0279	-55	6	TTTAGGTAAGTTATACTTTTA
Lactobacillus fermentum IFO 3956	LAF_1390	-54	6	TTTAGGTATTTTTTACTTTAA
Lactobacillus helveticus DPC 4571	lhv_0929	-74	6	TAAAAGTAACTTAGACTTTTA
Lactobacillus reuteri JCM 1112	LAR_0149	-75	6.1	TAAAAGTTAATCATACTTTTA
Lactobacillus rhamnosus GG	LGG_02764	-41	6.5	TTTAAGTAAATTTTACTTTAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --