Propagation of Zur regulog to Prochlorococcus marinus str. NATL1A
| Source regulog: | Zur - Cyanobacteria |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Cyanobacteria |
| Propagated regulon: | |
| Target genome | Prochlorococcus marinus str. NATL1A |
| Orthologous TF(s) | null |
| Regulated genes | 2 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -40
Score: 5.8 Sequence: ATGAAAATGATTATCGTTTTAGA
Locus tag: null
|
||||
| null | -40 | 5.8 | ATGAAAATGATTATCGTTTTAGA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: cce_1484 | ||||
| Ortholog function: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein | ||||
| Prochlorococcus marinus str. MIT 9313 | PMT2203 | -34 | 6 | ATAAAAATGGGAATCATTCTCAT |
| Synechococcus sp. WH 8102 | SYNW0971 | 37 | 6.3 | GTAAAAATGATAATCATTCTCAT |
| Gloeobacter violaceus PCC 7421 | glr1694 | -6 | 5.3 | TCTAGAATGAGAATCATTCTTGA |