Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of Zur regulog to Synechococcus sp. WH 5701

Reference regulog properties
Source regulog: Zur - Cyanobacteria
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Cyanobacteria
Propagated regulon:
Target genome Synechococcus sp. WH 5701
Orthologous TF(s) WH5701_11579
Regulated genes 2
Built upon 84 sites [see more]
Predicted regulatory interactions in Synechococcus sp. WH 5701
Locus tag Position Score Sequence
Position: -39
Score: 5.3
Sequence: ATGAGAACTGTTATCATTCTTAA
Locus tag: WH5701_11569
WH5701_11569 -39 5.3 ATGAGAACTGTTATCATTCTTAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: cce_1484
Ortholog function: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein
Prochlorococcus marinus str. MIT 9313 PMT2203 -34 6 ATAAAAATGGGAATCATTCTCAT
Synechococcus sp. WH 8102 SYNW0971 37 6.3 GTAAAAATGATAATCATTCTCAT
Gloeobacter violaceus PCC 7421 glr1694 -6 5.3 TCTAGAATGAGAATCATTCTTGA
© 2009-2020 RegPrecise