Propagation of Zur regulog to Prochlorococcus marinus sp. MED4

Reference regulog properties
Source regulog:	Zur - Cyanobacteria
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Phylum:	Cyanobacteria
Propagated regulon:
Target genome	Prochlorococcus marinus sp. MED4
Orthologous TF(s)	PMM1030
Regulated genes	3

Built upon 84 sites [see more]

Predicted regulatory interactions in *Prochlorococcus marinus sp. MED4*
	Locus tag	Position	Score	Sequence
Position: -120 Score: 6.5 Sequence: TTAAAAATGATAATCATTTTCAT Locus tag: PMM1031
	PMM1031	-120	6.5	TTAAAAATGATAATCATTTTCAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: cce_1485
Ortholog function: Predicted Mn/Zn chelate ABC transporter, ATP-binding protein
Prochlorococcus marinus str. MIT 9313	PMT2202	-111	6	ATGAGAATGATTCCCATTTTTAT
Synechococcus sp. WH 8102	SYNW0970	-83	6.3	ATGAGAATGATTATCATTTTTAC

Position: -41 Score: 6.5 Sequence: ATGAAAATGATTATCATTTTTAA Locus tag: PMM1032
	PMM1032	-41	6.5	ATGAAAATGATTATCATTTTTAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: cce_1484
Ortholog function: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein
Prochlorococcus marinus str. MIT 9313	PMT2203	-34	6	ATAAAAATGGGAATCATTCTCAT
Synechococcus sp. WH 8102	SYNW0971	37	6.3	GTAAAAATGATAATCATTCTCAT
Gloeobacter violaceus PCC 7421	glr1694	-6	5.3	TCTAGAATGAGAATCATTCTTGA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --