Propagation of NrtR2 regulog to Nostoc sp. PCC 7120

Reference regulog properties
Source regulog:	NrtR2 - Cyanobacteria
Regulator type:	Transcription factor
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Phylum:	Cyanobacteria
Propagated regulon:
Target genome	Nostoc sp. PCC 7120
Orthologous TF(s)	No orthologous TFs found
Regulated genes	2

Built upon 5 sites [see more]

Predicted regulatory interactions in *Nostoc sp. PCC 7120*
	Locus tag	Position	Score	Sequence
Position: -36 Score: 4.3 Sequence: TTACAGTAGATTCAACAAAAT Locus tag: alr5162
	alr5162	-36	4.3	TTACAGTAGATTCAACAAAAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: pncA
Ortholog function: Nicotinamidase (EC 3.5.1.19)
Cyanothece sp. PCC 7425	Cyan7425_2210	-49	5.1	ATAGTGTTATTGAGACACTAT
		-26	5.9	TTAGTGTAGTTTATACACAAA
Synechococcus sp. PCC 7002	SYNPCC7002_A0642	-66	4.2	aatGTGTtttTaaaACACcAc

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --