Propagation of NrtR2 regulog to Cyanothece sp. PCC 7425

Reference regulog properties
Source regulog:	NrtR2 - Cyanobacteria
Regulator type:	Transcription factor
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Phylum:	Cyanobacteria
Propagated regulon:
Target genome	Cyanothece sp. PCC 7425
Orthologous TF(s)	Cyan7425_2119
Regulated genes	1

Built upon 5 sites [see more]

Predicted regulatory interactions in *Cyanothece sp. PCC 7425*
	Locus tag	Position	Score	Sequence
Position: -26 Score: 5.9 Sequence: TTAGTGTAGTTTATACACAAA Locus tag: Cyan7425_2213
	Cyan7425_2213	-26	5.9	TTAGTGTAGTTTATACACAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: Cyan7425_2213
Ortholog function: hypothetical protein
Cyanothece sp. PCC 7425	Cyan7425_2213	-49	5.1	ATAGTGTTATTGAGACACTAT
		-26	5.9	TTAGTGTAGTTTATACACAAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --