Propagation of AcrR regulog to Edwardsiella ictaluri 93-146
| Source regulog: | AcrR - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Multidrug resistance |
| Effector: | Rhodamine 6G; Ethidium bromide; Proflavin |
| Phylum: | Proteobacteria/gamma |
| Propagated regulon: | |
| Target genome | Edwardsiella ictaluri 93-146 |
| Orthologous TF(s) | NT01EI_1100 |
| Regulated genes | 2 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -113
Score: 7.7 Sequence: TACATACATTGATGAATGTATGTA
Locus tag: NT01EI_1099
|
||||
| NT01EI_1099 | -113 | 7.7 | TACATACATTGATGAATGTATGTA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: acrA | ||||
| Ortholog function: acriflavine resistance protein A | ||||
| Edwardsiella tarda EIB202 | ETAE_1011 | -113 | 7.4 | TACATGCATTGATGAATGTATGTA |
|
Position: -52
Score: 7.4 Sequence: TACATACATTCATCAATGTATGTA
Locus tag: NT01EI_1100
|
||||
| NT01EI_1100 | -52 | 7.4 | TACATACATTCATCAATGTATGTA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: acrR | ||||
| Ortholog function: acrAB operon repressor | ||||
| Escherichia coli str. K-12 substr. MG1655 | b0464 | -52 | 7.3 | TACATACATTCACAAATGTATGTA |
| Salmonella typhimurium LT2 | STM0477 | -52 | 6.9 | TACATACATCCATAAATGTATGTA |
| Citrobacter koseri ATCC BAA-895 | CKO_02687 | -52 | 6.9 | TACATACATCCACAAATGTATGTA |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_00445 | -52 | 7.3 | TACATACATTCACAAATGTATGTA |
| Enterobacter sp. 638 | Ent638_0944 | -52 | 7.4 | TACATACATTCATAAATGTATGTA |
| Erwinia amylovora ATCC 49946 | EAM_1018 | -52 | 7.3 | TACATACATTCGCAAATGTATGTA |
| Yersinia pestis KIM | y1051 | -52 | 7.9 | TACATACATTCGTGAATGTATGTA |
| Serratia proteamaculans 568 | Spro_1128 | -52 | 7.3 | TACATACATACGCGAATGTATGTA |
| Erwinia carotovora subsp. atroseptica SCRI1043 | ECA1171 | -75 | 7 | TACATACATACTTGAATGTATGTA |
| Edwardsiella tarda EIB202 | ETAE_1012 | -52 | 6.9 | TACATACATTCATCAATGCATGTA |
| Proteus mirabilis HI4320 | PMI0133 | -52 | 6.9 | TACAAACATACATGAATGTATGTA |
| Photorhabdus luminescens subsp. laumondii TTO1 | plu3850 | -52 | 6.9 | TACAAACATACGTGAATGTATGTA |