Propagation of AcrR regulog to Edwardsiella ictaluri 93-146

Reference regulog properties
Source regulog:	AcrR - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Multidrug resistance
Effector:	Rhodamine 6G; Ethidium bromide; Proflavin
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Edwardsiella ictaluri 93-146
Orthologous TF(s)	NT01EI_1100
Regulated genes	2

Built upon 24 sites [see more]

Predicted regulatory interactions in *Edwardsiella ictaluri 93-146*
	Locus tag	Position	Score	Sequence
Position: -113 Score: 7.7 Sequence: TACATACATTGATGAATGTATGTA Locus tag: NT01EI_1099
	NT01EI_1099	-113	7.7	TACATACATTGATGAATGTATGTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: acrA
Ortholog function: acriflavine resistance protein A
Edwardsiella tarda EIB202	ETAE_1011	-113	7.4	TACATGCATTGATGAATGTATGTA

Position: -52 Score: 7.4 Sequence: TACATACATTCATCAATGTATGTA Locus tag: NT01EI_1100
	NT01EI_1100	-52	7.4	TACATACATTCATCAATGTATGTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: acrR
Ortholog function: acrAB operon repressor
Escherichia coli str. K-12 substr. MG1655	b0464	-52	7.3	TACATACATTCACAAATGTATGTA
Salmonella typhimurium LT2	STM0477	-52	6.9	TACATACATCCATAAATGTATGTA
Citrobacter koseri ATCC BAA-895	CKO_02687	-52	6.9	TACATACATCCACAAATGTATGTA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	KPN_00445	-52	7.3	TACATACATTCACAAATGTATGTA
Enterobacter sp. 638	Ent638_0944	-52	7.4	TACATACATTCATAAATGTATGTA
Erwinia amylovora ATCC 49946	EAM_1018	-52	7.3	TACATACATTCGCAAATGTATGTA
Yersinia pestis KIM	y1051	-52	7.9	TACATACATTCGTGAATGTATGTA
Serratia proteamaculans 568	Spro_1128	-52	7.3	TACATACATACGCGAATGTATGTA
Erwinia carotovora subsp. atroseptica SCRI1043	ECA1171	-75	7	TACATACATACTTGAATGTATGTA
Edwardsiella tarda EIB202	ETAE_1012	-52	6.9	TACATACATTCATCAATGCATGTA
Proteus mirabilis HI4320	PMI0133	-52	6.9	TACAAACATACATGAATGTATGTA
Photorhabdus luminescens subsp. laumondii TTO1	plu3850	-52	6.9	TACAAACATACGTGAATGTATGTA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --