Propagation of MprA regulog to Edwardsiella ictaluri 93-146

Reference regulog properties
Source regulog:	MprA - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	MarR
Regulation mode:	repressor
Biological process:	Multidrug resistance
Effector:	2,4-Dinitrophenol; Carbonyl cyanide m-chlorophenylhydrazone
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Edwardsiella ictaluri 93-146
Orthologous TF(s)	NT01EI_3093
Regulated genes	2

Built upon 25 sites [see more]

Predicted regulatory interactions in *Edwardsiella ictaluri 93-146*
	Locus tag	Position	Score	Sequence
Position: -106 Score: 5.9 Sequence: ATTGATGAATGTATGTACCATA Locus tag: NT01EI_1099
	NT01EI_1099	-106	5.9	ATTGATGAATGTATGTACCATA
Supported by regulated orthologs from reference regulons
Ortholog gene name: acrA
Ortholog function: acriflavin resistance protein A
Edwardsiella tarda EIB202	ETAE_1011	-106	5.9	ATTGATGAATGTATGTACCATA

Position: -51 Score: 5.6 Sequence: ACTGATAACTGAAGTTACTATA Locus tag: NT01EI_3093
	NT01EI_3093	-51	5.6	ACTGATAACTGAAGTTACTATA
Supported by regulated orthologs from reference regulons
Ortholog gene name: mprA
Ortholog function: Transcriptional repressor mprA (EmrR protein)
Escherichia coli str. K-12 substr. MG1655	b2684	-51	6.9	ATTTGTCACTGTCGTTACTATA
Salmonella typhimurium LT2	STM2813	-51	6.9	ATTTGTCACTGTCGTTACTATA
Citrobacter koseri ATCC BAA-895	CKO_04033	-51	6.9	ATTTGTCACTGTCGTTACTATA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	KPN_03013	-150	6.2	ATTTGTCACAATAGTTATTATA
Enterobacter sp. 638	Ent638_3162	-51	6.9	ATTTGTCACTGTCGTTACTATA
Erwinia amylovora ATCC 49946	EAM_2603	-51	5.2	ATTAATCACCATCATTATTATA
Yersinia pestis KIM	y0923	-26	6.1	ATTAGTAACTATCGTTACTGTA
Serratia proteamaculans 568	Spro_3741	-50	6.1	ATTAATCACTATCGTTACTATC
Erwinia carotovora subsp. atroseptica SCRI1043	ECA3511	-53	5.4	TTTAGTAACATTAGTTACTATG
Edwardsiella tarda EIB202	ETAE_2765	-51	5.1	ACTGATAACCAAAGTTACTATA
Photorhabdus luminescens subsp. laumondii TTO1	plu1277	-51	4.1	TTTGATAACAAAAGTTATCTTA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --