Propagation of MprA regulog to Edwardsiella ictaluri 93-146
| Source regulog: | MprA - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | MarR |
| Regulation mode: | repressor |
| Biological process: | Multidrug resistance |
| Effector: | 2,4-Dinitrophenol; Carbonyl cyanide m-chlorophenylhydrazone |
| Phylum: | Proteobacteria/gamma |
| Propagated regulon: | |
| Target genome | Edwardsiella ictaluri 93-146 |
| Orthologous TF(s) | NT01EI_3093 |
| Regulated genes | 2 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -106
Score: 5.9 Sequence: ATTGATGAATGTATGTACCATA
Locus tag: NT01EI_1099
|
||||
| NT01EI_1099 | -106 | 5.9 | ATTGATGAATGTATGTACCATA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: acrA | ||||
| Ortholog function: acriflavin resistance protein A | ||||
| Edwardsiella tarda EIB202 | ETAE_1011 | -106 | 5.9 | ATTGATGAATGTATGTACCATA |
|
Position: -51
Score: 5.6 Sequence: ACTGATAACTGAAGTTACTATA
Locus tag: NT01EI_3093
|
||||
| NT01EI_3093 | -51 | 5.6 | ACTGATAACTGAAGTTACTATA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: mprA | ||||
| Ortholog function: Transcriptional repressor mprA (EmrR protein) | ||||
| Escherichia coli str. K-12 substr. MG1655 | b2684 | -51 | 6.9 | ATTTGTCACTGTCGTTACTATA |
| Salmonella typhimurium LT2 | STM2813 | -51 | 6.9 | ATTTGTCACTGTCGTTACTATA |
| Citrobacter koseri ATCC BAA-895 | CKO_04033 | -51 | 6.9 | ATTTGTCACTGTCGTTACTATA |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_03013 | -150 | 6.2 | ATTTGTCACAATAGTTATTATA |
| Enterobacter sp. 638 | Ent638_3162 | -51 | 6.9 | ATTTGTCACTGTCGTTACTATA |
| Erwinia amylovora ATCC 49946 | EAM_2603 | -51 | 5.2 | ATTAATCACCATCATTATTATA |
| Yersinia pestis KIM | y0923 | -26 | 6.1 | ATTAGTAACTATCGTTACTGTA |
| Serratia proteamaculans 568 | Spro_3741 | -50 | 6.1 | ATTAATCACTATCGTTACTATC |
| Erwinia carotovora subsp. atroseptica SCRI1043 | ECA3511 | -53 | 5.4 | TTTAGTAACATTAGTTACTATG |
| Edwardsiella tarda EIB202 | ETAE_2765 | -51 | 5.1 | ACTGATAACCAAAGTTACTATA |
| Photorhabdus luminescens subsp. laumondii TTO1 | plu1277 | -51 | 4.1 | TTTGATAACAAAAGTTATCTTA |