Propagation of PdhR regulog to Salmonella enterica subsp. enterica serovar Typhi str. E01-6750

Reference regulog properties
Source regulog:	PdhR - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Pyruvate metabolism
Effector:	Pyruvate
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Salmonella enterica subsp. enterica serovar Typhi str. E01-6750
Orthologous TF(s)	Salmonentericaenterica_010100017021, Salmonentericaenterica_010100040513
Regulated genes	1

Built upon 44 sites [see more]

Predicted regulatory interactions in *Salmonella enterica subsp. enterica serovar Typhi str. E01-6750*
	Locus tag	Position	Score	Sequence
Position: -71 Score: 5.7 Sequence: AACAATGGTTTTACCAATTGG Locus tag: Salmonentericaenterica_010100023665
	Salmonentericaenterica_010100023665	-71	5.7	AACAATGGTTTTACCAATTGG
Supported by regulated orthologs from reference regulons
Ortholog gene name: yfiD
Ortholog function: stress-induced alternate pyruvate formate-lyase subunit
Salmonella typhimurium LT2	STM2646	-71	5.7	AACAATGGTTTTACCAATTGG
Citrobacter koseri ATCC BAA-895	CKO_00205	-70	5.7	AACAATGGTTTTACCAATTGG
Enterobacter sp. 638	Ent638_3064	-67	5.7	AACAATGGTTTTACCAATTGG

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --