Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of KdgR regulog to Salmonella enterica subsp. enterica serovar Typhi str. 404ty

Reference regulog properties
Source regulog: KdgR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: IclR
Regulation mode: repressor (activator)
Biological process: Pectin and polygalacturonate utlization
Effector: 2-keto-3-deoxygluconate
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Salmonella enterica subsp. enterica serovar Typhi str. 404ty
Orthologous TF(s) Salmonelentericaenterica_010100024673, Salmonelentericaenterica_010100022513
Regulated genes 7
Built upon 159 sites [see more]
Predicted regulatory interactions in Salmonella enterica subsp. enterica serovar Typhi str. 404ty
Locus tag Position Score Sequence
Position: -286
Score: 4.7
Sequence: TTTTGAAACAGGGTTTTCATT
Locus tag: Salmonelentericaenterica_010100001441
Salmonelentericaenterica_010100001441 -286 4.7 TTTTGAAACAGGGTTTTCATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: pykF
Ortholog function: Pyruvate kinase (EC 2.7.1.40)
Escherichia coli str. K-12 substr. MG1655 b1676 -286 5 TTTTGAAACGCTGTTTTTGTT
Salmonella typhimurium LT2 STM1378 -286 4.7 TTTTGAAACAGGGTTTTCATT
Citrobacter koseri ATCC BAA-895 CKO_01709 -286 5 TTTTGAAACGCTGTTTTCATT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02133 -285 5 ATTTGAAACGAGGTTTTTATT
Enterobacter sp. 638 Ent638_1768 -286 5.1 TTTTGAAACGCCGTTTCCATT
Serratia proteamaculans 568 Spro_2187 -203 4.1 AAtaacAACAcatTTTCATcT
Erwinia carotovora subsp. atroseptica SCRI1043 ECA1867 -259 5.1 ATACGGAACGTCGTTTCAATT
Position: -124
Score: 6.2
Sequence: AAATGAAACGTTGTTTTATTT
Locus tag: Salmonelentericaenterica_010100020111
Salmonelentericaenterica_010100020111 -124 6.2 AAATGAAACGTTGTTTTATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: kduI
Ortholog function: 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase (EC 5.3.1.17)
Escherichia coli str. K-12 substr. MG1655 b2843 -130 6.3 AAATGAAACATTGTTTTATTT
-63 5.4 AAACGAAACAGTGTTTCACTA
Salmonella typhimurium LT2 STM3018 -123 6.2 AAATGAAACGTTGTTTTATTT
-58 5.3 AATCAAAACAGTGTTTTGATT
Citrobacter koseri ATCC BAA-895 CKO_04220 -119 6.2 AAATGAAACAACGTTTTATTT
-51 4.4 AAACGGAACGGTGTTTCGCCT
Enterobacter sp. 638 Ent638_3296 -127 5.4 AACTGAAACAACGTTTTAAAT
-60 5 AATCGGAACATTGTTTCGTTA
Yersinia pestis KIM y1887 -201 6 TAATAAAACATCATTTCATTT
Erwinia carotovora subsp. atroseptica SCRI1043 ECA2400 -209 6.1 AAATAAAACATTATTTCATTT
Edwardsiella tarda EIB202 ETAE_1898 -129 5.6 AATCAAAACAGCATTTCATTT
Position: -120
Score: 5.1
Sequence: AACAGAAACAATGTTTCATTC
Locus tag: Salmonelentericaenterica_010100021698
Salmonelentericaenterica_010100021698 -120 5.1 AACAGAAACAATGTTTCATTC
Supported by regulated orthologs from reference regulons
Ortholog gene name: yjcB
Ortholog function: putative inner membrane protein
Salmonella typhimurium LT2 STM4263 -120 5.4 AATAGAAACAATGTTTCATTC
Citrobacter koseri ATCC BAA-895 CKO_03830 -121 5.1 AACAGAAACGTTGTTTCATTC
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_04460 -113 4.9 AACAGAAATGGCGTTTCATCA
Position: -7
Score: 5
Sequence: TATTGAAATGTGGTTTCAACT
Locus tag: Salmonelentericaenterica_010100033374
Salmonelentericaenterica_010100033374 -7 5 TATTGAAATGTGGTTTCAACT
Supported by regulated orthologs from reference regulons
Ortholog gene name: yeeO
Ortholog function: predicted multidrug efflux system, MATE family
Escherichia coli str. K-12 substr. MG1655 b1985 -7 4.9 ATTTGAAATGTGGTTTCACTT
Salmonella typhimurium LT2 STM2013 -7 5 TATTGAAATGTGGTTTCAACT
Citrobacter koseri ATCC BAA-895 CKO_00837 -7 4.9 ATTTGAAATGAGGTTTCAACT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02447 -40 5.1 ATTTGAAATGTTGTTTCAACA
Enterobacter sp. 638 Ent638_2574 -74 5 ATTTGAAATGTAGTTTCAACT
Yersinia pestis KIM y2593 -158 4.8 TCATGAAACTATGTTCCATTT
Serratia proteamaculans 568 Spro_3106 -39 5.2 ATTTGAAATGTTGTTTCACTT
Erwinia carotovora subsp. atroseptica SCRI1043 ECA2762 -140 5.1 AATAGAAACGTCATTTTAAAA
Position: -188
Score: 5.8
Sequence: AAATAAAACATTATTTTAATT
Locus tag: Salmonelentericaenterica_010100042449
Salmonelentericaenterica_010100042449 -188 5.8 AAATAAAACATTATTTTAATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: kdgX
Ortholog function: predicted 2-keto-3-deoxygluconate permease
Salmonella typhimurium LT2 STM4395 -34 5.8 AAATAAAACATTATTTTAATT
Citrobacter koseri ATCC BAA-895 CKO_03627 -31 5.2 AAATAAAACATTATTTCAAAG
Enterobacter sp. 638 Ent638_0375 -33 5.9 AATTGAAACGTCATTTTATTT
Yersinia pestis KIM y1734 -22 5.8 TAACGAAACATCATTTCATTT
Position: -131
Score: 4.9
Sequence: AAATGAAACACACTTTTCATT
Locus tag: Salmonelentericaenterica_010100046900
Salmonelentericaenterica_010100046900 -131 4.9 AAATGAAACACACTTTTCATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: ppsR
Ortholog function: PEP synthetase regulatory protein
Escherichia coli str. K-12 substr. MG1655 b1703 -131 5.3 AAATGAAATGCTGTTTTCATA
Salmonella typhimurium LT2 STM1348 -131 4.9 AAATGAAACACACTTTTCATT
Citrobacter koseri ATCC BAA-895 CKO_01727 -107 5.5 TATAAAAATAGCGTTTCATTT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02161 -97 5.1 AACAAAAATAGCGTTTCAATT
Enterobacter sp. 638 Ent638_1744 -107 5.3 ATTAAAAACACCATTTCATTT
Serratia proteamaculans 568 Spro_2173 -134 5.2 ATTTGAAATAGTGTTTTACTT
Erwinia carotovora subsp. atroseptica SCRI1043 ECA1852 -94 5.6 TAATGAAATGGCGTTTTAATA