Propagation of IscR regulog to Sodalis glossinidius str. 'morsitans'
| Source regulog: | IscR - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | Rrf2 |
| Regulation mode: | activator (repressor) |
| Biological process: | Iron-sulfur cluster biogenesis |
| Effector: | Iron-sulfur cluster redox state |
| Phylum: | Proteobacteria/gamma |
| Propagated regulon: | |
| Target genome | Sodalis glossinidius str. 'morsitans' |
| Orthologous TF(s) | SG1770 |
| Regulated genes | 2 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -37
Score: 6.1 Sequence: ATATCCGACTATTTTAGTCAACTAT
Locus tag: SG2325
|
||||
| SG2325 | -37 | 6.1 | ATATCCGACTATTTTAGTCAACTAT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: nfuA | ||||
| Ortholog function: NfuA Fe-S protein maturation | ||||
| Escherichia coli str. K-12 substr. MG1655 | b3414 | -37 | 6.9 | ATAACCAACTAAAATAGTCAACTAT |
| Salmonella typhimurium LT2 | STM3511 | -37 | 6.9 | ATAACCAACTAAAATAGTCAACTAT |
| Citrobacter koseri ATCC BAA-895 | CKO_04835 | -37 | 6.7 | ATAACCAAGTAAAATAGTCAACTAT |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_03784 | -37 | 6.5 | ATAACCCAGTAAAATAGTCAACTAT |
| Enterobacter sp. 638 | Ent638_3827 | -37 | 6.1 | ATACCCAAGTATTTTAGTCAACTAT |
| Erwinia amylovora ATCC 49946 | EAM_3259 | -37 | 6.7 | ATAACCAACTGAATTAGTCAACTAT |
| Yersinia pestis KIM | y3903 | -37 | 6.3 | ATAACCGACAAGAGTAGTCAACTAT |
| Serratia proteamaculans 568 | Spro_4634 | -46 | 5.7 | ATAACCTAGTATAGAAGTCAACTAT |
| Erwinia carotovora subsp. atroseptica SCRI1043 | ECA4134 | -38 | 5.6 | ATAACCGATAAGTGCAGTCAACTAT |
| Edwardsiella tarda EIB202 | ETAE_3288 | -37 | 5.9 | ATAACCGACCGGAGAAGTCAACTAT |
| Proteus mirabilis HI4320 | PMI2926 | -38 | 6.3 | ATAACCAACCAGAACAGTCAACTAT |
| Photorhabdus luminescens subsp. laumondii TTO1 | plu0198 | -37 | 6.3 | ATAACCAACTATAGCAGTCAACTAT |