Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of YbzH regulog to Geobacillus sp. Y412MC10

Reference regulog properties
Source regulog: YbzH - Bacillales
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Metabolite transport
Effector:
Phylum: Firmicutes
Propagated regulon:
Target genome Geobacillus sp. Y412MC10
Orthologous TF(s) GYMC10_4745
Regulated genes 1
Built upon 8 sites [see more]
Predicted regulatory interactions in Geobacillus sp. Y412MC10
Locus tag Position Score Sequence
Position: -47
Score: 6.2
Sequence: ATATCGACAATTCACGATAT
Locus tag: GYMC10_4744
GYMC10_4744 -47 6.2 ATATCGACAATTCACGATAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: ybcL
Ortholog function: Putative efflux transporter
Bacillus amyloliquefaciens FZB42 RBAM_018550 -56 6.2 ATATCGATATATCACAATAT
Bacillus clausii KSM-K16 ABC1382 -75 5.9 ACATCGACATATCGCGATAT
Bacillus licheniformis DSM 13 BLi00210 -93 6.5 ATATCGACATATTTCGATGT
Bacillus subtilis subsp. subtilis str. 168 BSU01890 -90 6.4 ATATCGACATATTACGATGT