Propagation of YhcF regulog to Geobacillus sp. Y412MC10

Reference regulog properties
Source regulog:	YhcF - Bacillales
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Phylum:	Firmicutes
Propagated regulon:
Target genome	Geobacillus sp. Y412MC10
Orthologous TF(s)	GYMC10_5791
Regulated genes	1

Built upon 6 sites [see more]

Predicted regulatory interactions in *Geobacillus sp. Y412MC10*
	Locus tag	Position	Score	Sequence
Position: -49 Score: 6 Sequence: GTGTACTATTTAACTATAACAC Locus tag: GYMC10_5793
	GYMC10_5793	-49	6	GTGTACTATTTAACTATAACAC
Supported by regulated orthologs from reference regulons
Ortholog gene name: yhcH
Ortholog function: ABC transporter, ATP-binding protein
Paenibacillus sp. JDR-2	Pjdr2_3932	-44	5.5	GTGTACTATTCAACTATAACAC

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --