Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of SdaR regulog to Shigella dysenteriae 1012

Reference regulog properties
Source regulog: SdaR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: SdaR
Regulation mode: activator
Biological process: Glucarate utilization; Galactarate utilization
Effector: Glycerate
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Shigella dysenteriae 1012
Orthologous TF(s) Sdys1_01002047
Regulated genes 1
Built upon 31 sites [see more]
Predicted regulatory interactions in Shigella dysenteriae 1012
Locus tag Position Score Sequence
Position: -92
Score: 5.6
Sequence: CTTTGGGCATTTGCACAATG
Locus tag: Sdys1_01002047
Sdys1_01002047 -92 5.6 CTTTGGGCATTTGCACAATG
Supported by regulated orthologs from reference regulons
Ortholog gene name: sdaR
Ortholog function: Glycerate-responsive transcriptional regulator for hexarate utilization, SdaR family
Escherichia coli str. K-12 substr. MG1655 b0162 -69 5.3 CTTTAGGCATTTGCACAATG
Salmonella typhimurium LT2 STM0210 -71 5.8 TTTTGTGCATTTGCACAATG
Citrobacter koseri ATCC BAA-895 CKO_03205 -17 5.1 GTTTGTGCAGATGCACAATG
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_00177 -17 5.4 CTTAGTGCAAATGCACAATG
Enterobacter sp. 638 Ent638_0702 -71 5.3 CTTTGTGCATTCGCACAATG
Erwinia carotovora subsp. atroseptica SCRI1043 ECA3300 -80 4.3 CTTTGTTAATTTGCACAATG